Beer–Lambert Calculator
An NADH solution reading 0.5 absorbance at 340 nm in a 1 cm cuvette has a concentration of 80.3859 µmol/L.
Molar absorptivity in L/(mol·cm) gives c in mol/L; L/(g·cm) gives g/L.
0.00005
- Absorbance A
- 0.6
- Transmittance
- 25.1189 %
Step-by-step solution
- c = A ÷ (ε l) = 0.6 ÷ (12000 × 1) = 0.00005
Beer-Lambert Law Formula
A = ε l c
ε molar absorptivity (L/(mol·cm)), l path length (cm), c concentration (mol/L); T = 10^(−A)
Worked Example
NADH (ε₃₄₀ = 6220 L/(mol·cm)) reading A = 0.5 in a 1 cm cuvette:
- c = A ÷ (εl) = 0.5 ÷ (6220 × 1) = 0.00008038585209 mol/L
Transmittance T = 10^(−A): 31.6227766 %
GATE tip
Enzyme assays use the rate of absorbance change: rate (mol/L per min) = (ΔA/min) ÷ (εl). With NADH at 340 nm this converts directly to enzyme units.
Getting accurate concentrations
Measure at the wavelength of maximum absorption, λmax, where the reading is most sensitive. Keep absorbance between about 0.1 and 1.0 by diluting strong dye baths, and multiply the calculated concentration by the dilution factor. Use the same cell path length as the calibration and zero the instrument with the blank solvent. In dye-house practice, build a calibration line of absorbance against known concentrations rather than relying on a single ε value.
More Molecular Biology Tools Calculators
-
DNA Concentration Calculator
c = A260 × factor × dilution
factor 50 (dsDNA), 33 (ssDNA), 40 (RNA) µg/mL; copies = mass × Nₐ ÷ (length × 660 g/mol)
Example: A plasmid diluted 1:10 reading A260 = 0.5, A280 = 0.27, 3000 bp: Concentration = 250 ng/µL.
-
Primer Tm Calculator
Tm = 64.9 + 41(G + C − 16.4)/N
Wallace (under 14 nt): Tm = 2(A + T) + 4(G + C); salt-adjusted 81.5 + 16.6 log[Na⁺] + 0.41(%GC) − 675/N
Example: The M13 reverse primer AGCGGATAACAATTTCACACAGGA: Melting temperature Tm = 53.9667 °C.
-
PCR Amplification Calculator
N = N₀(1 + E)ⁿ
E efficiency (1 = perfect doubling); qPCR slope = −1/log₁₀(1 + E)
Example: 1000 starting copies amplified for 30 cycles at 95 % efficiency: Copies after n cycles = 502387000000.
-
Hardy-Weinberg Calculator
p² + 2pq + q² = 1, p + q = 1
p = (2·AA + Aa)/(2N); χ² = Σ(O − E)²/E with 1 degree of freedom
Example: A sample of 360 AA, 480 Aa and 160 aa individuals: Allele frequency p (A) = 0.6.
Frequently asked questions
Why should absorbance stay below about 1.5?
Above about 1.5–2 only 1–3 % of the light gets through, so stray light dominates and the reading flattens. High concentrations and scattering samples also bend the line; dilute into the 0.1–1.0 range
What is the relation to transmittance?
A = −log₁₀ T: A = 1 lets 10 % through, A = 2 only 1 %.
Sources
Last reviewed: . Factors are stored exactly and computed with 50-digit decimal arithmetic. See how we verify conversion factors.
Cite this page
APA
Scientific Converters. (2026, October 15). Beer–Lambert Calculator. Retrieved October 25, 2026, from https://scientificconverters.com/calculators/beer-lambert-calculator/
IEEE
Scientific Converters, "Beer–Lambert Calculator," scientificconverters.com. Accessed: Oct. 25, 2026. [Online]. Available: https://scientificconverters.com/calculators/beer-lambert-calculator/