Primer Tm Calculator
The 24-nt M13 reverse primer, 42 % GC, has a basic melting temperature of 53.9667 °C.
A, C, G, T (or U); spaces are ignored.
53.9666666666667 °C
Full answer, then cut to fewer decimals (not rounded):
- 53.9666666666667 °C
- 53.966666666666 °C
- 53.96666666666 °C
- 53.9666666666 °C
- 53.966666666 °C
- 53.96666666 °C
- 53.9666666 °C
- 53.966666 °C
- 53.96666 °C
- 53.9666 °C
- 53.966 °C
- 53.96 °C
- 53.9 °C
- Length
- 24 nt
- GC content
- 41.66666667 %
- Wallace rule 2(A+T) + 4(G+C)
- 68 °C
- Basic formula 64.9 + 41(G+C − 16.4)/N
- 53.96666667 °C
- Salt-adjusted (50 mM Na⁺)
- 48.86123541 °C
- Molecular weight (anhydrous, 5′-OH)
- 7378.89 g/mol
Step-by-step solution
- A+T = 14, G+C = 10, N = 24
- Tm = 64.9 + 41 × (10 − 16.4) ÷ 24 = 53.96666667 °C
Primer Tm Formula
Tm = 64.9 + 41(G + C − 16.4)/N
Wallace (under 14 nt): Tm = 2(A + T) + 4(G + C); salt-adjusted 81.5 + 16.6 log[Na⁺] + 0.41(%GC) − 675/N
Worked Example
The M13 reverse primer AGCGGATAACAATTTCACACAGGA:
- A+T = 14, G+C = 10, N = 24
- Tm = 64.9 + 41 × (10 − 16.4) ÷ 24 = 53.96666667 °C
GC content: 41.66666667 % · Wallace rule 2(A+T) + 4(G+C): 68 °C · Basic formula 64.9 + 41(G+C − 16.4)/N: 53.96666667 °C · Salt-adjusted (50 mM Na⁺): 48.86123541 °C · Molecular weight (anhydrous, 5′-OH): 7378.89 g/mol
GATE tip
Each G·C pair has three hydrogen bonds and stronger stacking than A·T, which is why GC content raises Tm (4 °C per GC versus 2 °C per AT in the Wallace rule).
More Molecular Biology Tools Calculators
-
DNA Concentration Calculator
c = A260 × factor × dilution
factor 50 (dsDNA), 33 (ssDNA), 40 (RNA) µg/mL; copies = mass × Nₐ ÷ (length × 660 g/mol)
Example: A plasmid diluted 1:10 reading A260 = 0.5, A280 = 0.27, 3000 bp: Concentration = 250 ng/µL.
-
PCR Amplification Calculator
N = N₀(1 + E)ⁿ
E efficiency (1 = perfect doubling); qPCR slope = −1/log₁₀(1 + E)
Example: 1000 starting copies amplified for 30 cycles at 95 % efficiency: Copies after n cycles = 502387000000.
-
Hardy-Weinberg Calculator
p² + 2pq + q² = 1, p + q = 1
p = (2·AA + Aa)/(2N); χ² = Σ(O − E)²/E with 1 degree of freedom
Example: A sample of 360 AA, 480 Aa and 160 aa individuals: Allele frequency p (A) = 0.6.
-
Beer–Lambert Calculator
A = ε l c = −log₁₀ T
ε absorptivity, l path length (cm), c concentration, T transmittance
Example: A dye solution with absorbance 0.6 in a 1 cm cell, ε = 12 000 L/(mol·cm): Concentration c = 80.3859 µmol/L.
Frequently asked questions
Which Tm formula should I trust?
Nearest-neighbour thermodynamics is most accurate; the basic and Wallace formulas are quick estimates. Use the same method for both primers of a pair.
How should primers be matched?
Keep the two Tm values within about 2–5 °C and anneal roughly 3–5 °C below the lower Tm.
Sources
- The International System of Units (SI), 9th edition (SI Brochure), Bureau International des Poids et Mesures .
Last reviewed: . Factors are stored exactly and computed with 50-digit decimal arithmetic. See how we verify conversion factors.
Cite this page
APA
Scientific Converters. (2026, October 15). Primer Tm Calculator. Retrieved October 25, 2026, from https://scientificconverters.com/calculators/primer-tm-calculator/
IEEE
Scientific Converters, "Primer Tm Calculator," scientificconverters.com. Accessed: Oct. 25, 2026. [Online]. Available: https://scientificconverters.com/calculators/primer-tm-calculator/