Centrifuge RCF Calculator
A centrifuge spinning at 12,000 rpm with a 10 cm rotor radius applies 16099.5 × g.
16099.488 × g
Full answer, then cut to fewer decimals (not rounded):
- 16099.488 × g
- 16099.48 × g
- 16099.4 × g
- Angular speed ω
- 1256.637061 rad/s
Step-by-step solution
- RCF = 1.118 × 10⁻⁵ × r(cm) × rpm² = 1.118 × 10⁻⁵ × 10 × 12000²
- RCF = 16099.488 × g
Centrifuge RCF Formula
RCF = 1.118 × 10⁻⁵ × r × rpm²
r rotor radius in cm (centre to the tube bottom); rpm = √(RCF/(1.118 × 10⁻⁵ r))
Worked Example
A microcentrifuge at 12,000 rpm with a 10 cm rotor radius:
- RCF = 1.118 × 10⁻⁵ × r(cm) × rpm² = 1.118 × 10⁻⁵ × 10 × 12000²
- RCF = 16099.488 × g
GATE tip
The constant 1.118 × 10⁻⁵ is ω²r/g with ω = 2π rpm/60 and r in cm: (2π/60)² ÷ 980.665 = 1.1180 × 10⁻⁵.
More Molecular Biology Tools Calculators
-
Hemocytometer Cell Count Calculator
Cells/mL = average per large square × dilution × 10⁴
each large square holds 0.1 µL (1 mm × 1 mm × 0.1 mm); viability = live ÷ total
Example: Counts of 45, 52, 48 and 50 cells in four squares after a 1:1 trypan blue dilution: Cell density = 975000 cells/mL.
-
Primer Tm Calculator
Tm = 64.9 + 41(G + C − 16.4)/N
Wallace (under 14 nt): Tm = 2(A + T) + 4(G + C); salt-adjusted 81.5 + 16.6 log[Na⁺] + 0.41(%GC) − 675/N
Example: The M13 reverse primer AGCGGATAACAATTTCACACAGGA: Melting temperature Tm = 53.9667 °C.
-
DNA Concentration Calculator
c = A260 × factor × dilution
factor 50 (dsDNA), 33 (ssDNA), 40 (RNA) µg/mL; copies = mass × Nₐ ÷ (length × 660 g/mol)
Example: A plasmid diluted 1:10 reading A260 = 0.5, A280 = 0.27, 3000 bp: Concentration = 250 ng/µL.
-
PCR Amplification Calculator
N = N₀(1 + E)ⁿ
E efficiency (1 = perfect doubling); qPCR slope = −1/log₁₀(1 + E)
Example: 1000 starting copies amplified for 30 cycles at 95 % efficiency: Copies after n cycles = 502387000000.
Frequently asked questions
Why quote × g instead of rpm?
The force depends on the radius as well as speed, so × g makes protocols portable between different centrifuges and rotors.
Which radius should I use?
The maximum radius (to the tube bottom) for r_max; some protocols use the average radius. It is printed on the rotor or in its manual.
Sources
- The International System of Units (SI), 9th edition (SI Brochure), Bureau International des Poids et Mesures .
Last reviewed: . Factors are stored exactly and computed with 50-digit decimal arithmetic. See how we verify conversion factors.
Cite this page
APA
Scientific Converters. (2026, October 15). Centrifuge RCF Calculator. Retrieved October 25, 2026, from https://scientificconverters.com/calculators/centrifuge-rcf-calculator/
IEEE
Scientific Converters, "Centrifuge RCF Calculator," scientificconverters.com. Accessed: Oct. 25, 2026. [Online]. Available: https://scientificconverters.com/calculators/centrifuge-rcf-calculator/