Hemocytometer Cell Count Calculator
Counts of 45, 52, 48 and 50 cells per square after a 1:1 trypan blue dilution mean 975000 cells/mL in the original suspension.
975000 cells/mL
- Average per large square
- 48.75
- Viability (live / total)
- 93.84615385 %
- Live cell density
- 915000 cells/mL
- Cells in the suspension
- 9750000
Step-by-step solution
- Average = 195 ÷ 4 = 48.75 cells per 0.1 µL square
- Cells/mL = average × dilution × 10⁴ = 48.75 × 2 × 10⁴ = 975000
Hemocytometer Cell Count Formula
Cells/mL = average per large square × dilution × 10⁴
each large square holds 0.1 µL (1 mm × 1 mm × 0.1 mm); viability = live ÷ total
Worked Example
Counts of 45, 52, 48 and 50 cells in four squares after a 1:1 trypan blue dilution:
- Average = 195 ÷ 4 = 48.75 cells per 0.1 µL square
- Cells/mL = average × dilution × 10⁴ = 48.75 × 2 × 10⁴ = 975000
Viability (live / total): 93.84615385 % · Live cell density: 915000 cells/mL · Cells in the suspension: 9750000
GATE tip
To seed a target density, use C₁V₁ = C₂V₂ with the counted density as C₁, the same step as preparing a chemical dilution.
More Molecular Biology Tools Calculators
-
Centrifuge RCF Calculator
RCF = 1.118 × 10⁻⁵ × r × rpm²
r rotor radius in cm (centre to the tube bottom); rpm = √(RCF/(1.118 × 10⁻⁵ r))
Example: A microcentrifuge at 12,000 rpm with a 10 cm rotor radius: RCF = 16099.5 × g.
-
Primer Tm Calculator
Tm = 64.9 + 41(G + C − 16.4)/N
Wallace (under 14 nt): Tm = 2(A + T) + 4(G + C); salt-adjusted 81.5 + 16.6 log[Na⁺] + 0.41(%GC) − 675/N
Example: The M13 reverse primer AGCGGATAACAATTTCACACAGGA: Melting temperature Tm = 53.9667 °C.
-
DNA Concentration Calculator
c = A260 × factor × dilution
factor 50 (dsDNA), 33 (ssDNA), 40 (RNA) µg/mL; copies = mass × Nₐ ÷ (length × 660 g/mol)
Example: A plasmid diluted 1:10 reading A260 = 0.5, A280 = 0.27, 3000 bp: Concentration = 250 ng/µL.
-
PCR Amplification Calculator
N = N₀(1 + E)ⁿ
E efficiency (1 = perfect doubling); qPCR slope = −1/log₁₀(1 + E)
Example: 1000 starting copies amplified for 30 cycles at 95 % efficiency: Copies after n cycles = 502387000000.
Frequently asked questions
Why multiply by 10⁴?
One large square of a Neubauer chamber holds 0.1 mm³ = 10⁻⁴ mL, so cells per square × 10⁴ gives cells per mL.
How many cells should I count?
Aim for 100–300 cells in total for about 10 % counting error; dilute or concentrate the sample if needed.
Sources
- The International System of Units (SI), 9th edition (SI Brochure), Bureau International des Poids et Mesures .
Last reviewed: . Factors are stored exactly and computed with 50-digit decimal arithmetic. See how we verify conversion factors.
Cite this page
APA
Scientific Converters. (2026, October 15). Hemocytometer Cell Count Calculator. Retrieved October 25, 2026, from https://scientificconverters.com/calculators/hemocytometer-calculator/
IEEE
Scientific Converters, "Hemocytometer Cell Count Calculator," scientificconverters.com. Accessed: Oct. 25, 2026. [Online]. Available: https://scientificconverters.com/calculators/hemocytometer-calculator/