DNA Concentration Calculator
A 1:10 dilution of plasmid DNA reading A260 = 0.5 corresponds to 250 ng/µL in the stock, about 7.6 × 10¹⁰ copies of a 3 kb plasmid per µL.
250 ng/µL
- In µg/mL (same number)
- 250 µg/mL
- Purity A260/A280
- 1.851851852
- Purity
- good for DNA (≈ 1.8) / RNA (≈ 2.0)
- Copies per µL
- 76037130810
- Molarity
- 126.2626263 nM
- Total yield in the stock
- 12.5 µg
Step-by-step solution
- Concentration = A260 × 50 µg/mL × dilution = 0.5 × 50 × 10 = 250 ng/µL
- Copies/µL = (ng/µL × 10⁻⁹ × 6.022 × 10²³) ÷ (length × 660 g/mol) = 76037130810
DNA Concentration Formula
c = A260 × factor × dilution
factor 50 (dsDNA), 33 (ssDNA), 40 (RNA) µg/mL; copies = mass × Nₐ ÷ (length × 660 g/mol)
Worked Example
A plasmid diluted 1:10 reading A260 = 0.5, A280 = 0.27, 3000 bp:
- Concentration = A260 × 50 µg/mL × dilution = 0.5 × 50 × 10 = 250 ng/µL
- Copies/µL = (ng/µL × 10⁻⁹ × 6.022 × 10²³) ÷ (length × 660 g/mol) = 76037130810
Purity A260/A280: 1.851851852 · Purity: good for DNA (≈ 1.8) / RNA (≈ 2.0) · Copies per µL: 76037130810 · Molarity: 126.2626263 nM · Total yield in the stock: 12.5 µg
GATE tip
Absorbance readings are most reliable between about 0.1 and 1.0. Dilute concentrated samples into that range and multiply back by the dilution factor.
More Molecular Biology Tools Calculators
-
Primer Tm Calculator
Tm = 64.9 + 41(G + C − 16.4)/N
Wallace (under 14 nt): Tm = 2(A + T) + 4(G + C); salt-adjusted 81.5 + 16.6 log[Na⁺] + 0.41(%GC) − 675/N
Example: The M13 reverse primer AGCGGATAACAATTTCACACAGGA: Melting temperature Tm = 53.9667 °C.
-
PCR Amplification Calculator
N = N₀(1 + E)ⁿ
E efficiency (1 = perfect doubling); qPCR slope = −1/log₁₀(1 + E)
Example: 1000 starting copies amplified for 30 cycles at 95 % efficiency: Copies after n cycles = 502387000000.
-
Beer–Lambert Calculator
A = ε l c = −log₁₀ T
ε absorptivity, l path length (cm), c concentration, T transmittance
Example: A dye solution with absorbance 0.6 in a 1 cm cell, ε = 12 000 L/(mol·cm): Concentration c = 80.3859 µmol/L.
-
Hardy-Weinberg Calculator
p² + 2pq + q² = 1, p + q = 1
p = (2·AA + Aa)/(2N); χ² = Σ(O − E)²/E with 1 degree of freedom
Example: A sample of 360 AA, 480 Aa and 160 aa individuals: Allele frequency p (A) = 0.6.
Frequently asked questions
What does A260/A280 tell me?
About 1.8 for pure DNA and 2.0 for pure RNA; lower values suggest protein or phenol contamination.
Why 660 g/mol per base pair?
It is the average mass of a sodium-salt base pair. Some calculators use 650; the difference is about 1.5 %.
Sources
- The International System of Units (SI), 9th edition (SI Brochure), Bureau International des Poids et Mesures .
Last reviewed: . Factors are stored exactly and computed with 50-digit decimal arithmetic. See how we verify conversion factors.
Cite this page
APA
Scientific Converters. (2026, October 15). DNA Concentration Calculator. Retrieved October 25, 2026, from https://scientificconverters.com/calculators/dna-concentration-calculator/
IEEE
Scientific Converters, "DNA Concentration Calculator," scientificconverters.com. Accessed: Oct. 25, 2026. [Online]. Available: https://scientificconverters.com/calculators/dna-concentration-calculator/