Hardy-Weinberg Calculator
A sample of 360 AA, 480 Aa and 160 aa gives an allele frequency of 0.6 for A; the counts match Hardy–Weinberg exactly.
0.6
- Allele frequency q (a)
- 0.4
- Expected AA : Aa : aa
- 360 : 480 : 160
- Chi-square (1 degree of freedom)
- 0
- At 5 % significance (χ² < 3.841)
- consistent with Hardy–Weinberg equilibrium
Step-by-step solution
- p = (2 × AA + Aa) ÷ 2N = (720 + 480) ÷ 2000 = 0.6
- Expected: p²N = 360, 2pqN = 480, q²N = 160
- χ² = Σ(O − E)²/E = 0
Hardy-Weinberg Formula
p² + 2pq + q² = 1, p + q = 1
p = (2·AA + Aa)/(2N); χ² = Σ(O − E)²/E with 1 degree of freedom
Worked Example
A sample of 360 AA, 480 Aa and 160 aa individuals:
- p = (2 × AA + Aa) ÷ 2N = (720 + 480) ÷ 2000 = 0.6
- Expected: p²N = 360, 2pqN = 480, q²N = 160
- χ² = Σ(O − E)²/E = 0
Expected AA : Aa : aa: 360 : 480 : 160 · Chi-square (1 degree of freedom): 0 · At 5 % significance (χ² < 3.841): consistent with Hardy–Weinberg equilibrium
GATE tip
The χ² test for Hardy–Weinberg has 1 degree of freedom (3 classes − 1 − 1 estimated parameter), so the 5 % critical value is 3.841.
More Molecular Biology Tools Calculators
-
Primer Tm Calculator
Tm = 64.9 + 41(G + C − 16.4)/N
Wallace (under 14 nt): Tm = 2(A + T) + 4(G + C); salt-adjusted 81.5 + 16.6 log[Na⁺] + 0.41(%GC) − 675/N
Example: The M13 reverse primer AGCGGATAACAATTTCACACAGGA: Melting temperature Tm = 53.9667 °C.
-
DNA Concentration Calculator
c = A260 × factor × dilution
factor 50 (dsDNA), 33 (ssDNA), 40 (RNA) µg/mL; copies = mass × Nₐ ÷ (length × 660 g/mol)
Example: A plasmid diluted 1:10 reading A260 = 0.5, A280 = 0.27, 3000 bp: Concentration = 250 ng/µL.
-
PCR Amplification Calculator
N = N₀(1 + E)ⁿ
E efficiency (1 = perfect doubling); qPCR slope = −1/log₁₀(1 + E)
Example: 1000 starting copies amplified for 30 cycles at 95 % efficiency: Copies after n cycles = 502387000000.
-
Beer–Lambert Calculator
A = ε l c = −log₁₀ T
ε absorptivity, l path length (cm), c concentration, T transmittance
Example: A dye solution with absorbance 0.6 in a 1 cm cell, ε = 12 000 L/(mol·cm): Concentration c = 80.3859 µmol/L.
Frequently asked questions
What are the Hardy–Weinberg assumptions?
Large random-mating population with no selection, mutation, migration or genetic drift. Departures from equilibrium point to one of these.
How do I find carriers of a recessive disease?
If 1 in 2500 is affected, q² = 0.0004, q = 0.02 and carriers 2pq ≈ 0.039, about 1 in 25.
Sources
- The International System of Units (SI), 9th edition (SI Brochure), Bureau International des Poids et Mesures .
Last reviewed: . Factors are stored exactly and computed with 50-digit decimal arithmetic. See how we verify conversion factors.
Cite this page
APA
Scientific Converters. (2026, October 15). Hardy-Weinberg Calculator. Retrieved October 25, 2026, from https://scientificconverters.com/calculators/hardy-weinberg-calculator/
IEEE
Scientific Converters, "Hardy-Weinberg Calculator," scientificconverters.com. Accessed: Oct. 25, 2026. [Online]. Available: https://scientificconverters.com/calculators/hardy-weinberg-calculator/